Cas12a (fnCpf1) Nuclease NLS Protein
Cat. No. | K187 | |
Name | Cas12a (fnCpf1) Nuclease NLS Protein | |
Unit | 380 μg (2.5 nmol/250 µL) | |
Category | Cas Proteins & CRISPR Screening | |
Description |
Using Cas12a (fnCpf1) in your CRISPR experiment offers several advantages over other CRISPR-associated nucleases.
fnCpf1 is from the bacteria Francisella novicida. This protein contains a SV40 T antigen nuclear localization signal (NLS) on the N-terminus of the protein. If the cut caused by fnCpf1 is repaired by non-homologous end joining (NHEJ), an indel may be formed that disrupts the open reading frame of the targeted gene, leading to gene knockout. Alternatively, by supplying a repair template, a sequence can be knocked in at the cleavage site via homology directed repair (HDR).
|
|
Cas Type | Nuclease | |
Cas Origin | fnCpf1 | |
Cas Protein Marker | No GFP | |
Concentration | 10 μM, 1.5 mg/ml | |
Format General | Enzyme supplied with 10X Reaction Buffer | |
Storage Buffer | 10 mM Tris-HCl (pH 7.4), 0.1 mM EDTA, 1 mM DTT, 300 mM NaCl, and 50% (v/v) Glycerol. | |
Storage Condition | Store all components at -20°C. | |
Caution | This product is distributed for laboratory research only. Not for diagnostic use. | |
Material Citation | If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. K187 |
Search CoA here
MSDS
What is the crRNA scaffold sequence for fnCpf1? | |
TAATTTCTACTGTTGTAGAT is the crRNA scaffold.
|
What is the source of this enzyme? | |
The enzyme is produced recombinantly in E. coli, which has been engineered to express the enzyme gene. While the original gene may come from another organism, all production and purification occur using E. coli under controlled conditions.
|
There are no references for this product yet!
This product has no review yet.
Controls and Related Product: