Lenti-SV40T Virus, High Titer
| Cat. No. | LV665 |
| Name | Lenti-SV40T Virus, High Titer |
| Unit | 2 x 100 μl |
| Unpacking and Storage Instructions |
Lentiviruses are shipped with dry ice. For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles. |
| Description |
High Titer (109 IU/ml) Recombinant Lentivirus expressing the SV40 large T antigen. |
| Application |
Cell immortalization. |
| Expression System Type | Lentivirus |
| Caution |
This product is distributed for laboratory |
| Material Citation | If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. LV665 |
Print/Download Datasheet
| What PCR primers can I use for SV40 large T detection? | |
|
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
Expected band size: 792bp
|
| What qPCR primers can I use for SV40 large T detection? | |
|
SV40 Forward Primer Sequence
TTCCCTGACCTGAAGGCAAATC
SV40 Reverse Primer Sequence
GGCTGAACTTTGAGCTAGGAGTAG
|
- Zhou, N., Tian, Y., Wu, H., Cao, Y., Li, R., Zou, K., Xu, W., & Lu, L. (2022). Protective Effect of Resveratrol on Immortalized Duck Intestinal Epithelial Cells Exposed to H2O2. Molecules, 27(11), 3542. https://doi.org/10.3390/molecules27113542
This product has no review yet.
Controls and Related Product: