Lenti-SV40T (Puro) Virus, High Titer
| Cat. No. | LV613 |
| Name | Lenti-SV40T (Puro) Virus, High Titer |
| Unit | 2 x 100 µl |
| Unpacking and Storage Instructions |
Lentiviruses are shipped with dry ice. For long term storage, it is recommended to store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles. |
| Description |
High Titer (109IU/ml) Recombinant Lentivirus expressing the SV40 large T antigen. |
| Application |
Cell immortalization. |
| Expression System Type | Lentivirus |
| Note |
Not for resale without prior written consent of abm. |
| Caution |
This product is distributed for laboratory research only. |
| Material Citation | If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. LV613 |
Print/Download Datasheet
| What PCR primers can I use for SV40 large T detection? | |
|
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
Expected band size: 792bp
|
| What qPCR primers can I use for SV40 large T detection? | |
|
SV40 Forward Primer Sequence
TTCCCTGACCTGAAGGCAAATC
SV40 Reverse Primer Sequence
GGCTGAACTTTGAGCTAGGAGTAG
|
- Wu, L et al. " Immortalized Mouse Floxed Bmp2 Dental Papilla Mesenchymal Cell Lines Preserve Odontoblastic Phenotype and Respond to BMP2. J. Cell" Physiol 225:132-139 (2010). DOI: 10.1002/jcp.22204. Application: Immortalization.
- Olyslaegers, D et al. "Generation and characterization of feline arterial and genous endothelial cell lines for the study of the vascular endothelium" BMC Veterinary Research 9:170 (2013). DOI: 10.1186/1746-6148-9-170. Application: Immortalization.
- Desmarets, L et al. "Establishment of feline intestinal epithelial cell cultures for the propagation and study of feline" Veterinary Research 44:71 (2013). DOI: 10.1186/1297-9716-44-71. Application: Immortalization.
- Balducci, L et al. "Immortalization of human adipose-derived stromal cells: production of cell lines with high growth rate, mesenchymal marker expression and capability to secrete high levels of angiogenic factors" Stem Cell Research & Therapy 3:63 (2014). DOI: 10.1186/scrt452. PubMed: 24887516. Application: Immortalization.
- Wong, SY et al. "Primary cilia can both mediate and suppress Hedgehog pathway–dependent tumorigenesis" Nat. Med. 9:1055 - 1061 (2009). DOI: doi:10.1038/nm.2011. PubMed: 19701205. Application: Immortalization.
- Wang, ZY et al. "Immortalized porcine liver sinusoidal endothelial cells: an in vitro model of xenotransplantation-induced thrombocytopenia" Xenotransplantation 19:249-55 (2012). PubMed: 22909138.
- Chen, Q et al. "Pharmacological inhibition of S-nitrosoglutathione reductase improves endothelial vasodilatory function in rats in vivo" J. Appl. Physiol. 6:752-60 (2013). DOI: 10.1152/japplphysiol.01302.2012. PubMed: 23349456. Application: Immortalization.
- Zhao, Y et al. "microRNA response elements-regulated TRAIL expression shows specific survival-suppressing activity on bladder cancer." J Exp Clin Cancer Res 32(1):10 (2013). DOI: 10.1186/1756-9966-32-10. PubMed: 23442927. Application: Immortalization.
- Liu, J et al. "Oleanolic acid inhibits proliferation and invasiveness of Kras-transformed cells via autophagy" J Nutr Biochem 25(11):1154-1160 (2014). DOI: 10.1016/j.jnutbio.2014.06.006. PubMed: 25172632.
- Nauwynck, H.J. et al. "Generation and Characterization of feline arterial and cenous endotheilial cell lines for the study of the vascular endothelium " Biomed Central 9: (2013). DOI: 10.1186/1746-6148-9-170. Application: Gene Delivery.
- Laval, et al. "Equine Herpesvirus Type 1 Enhances Viral Replication in CD172a+ Monocytic Cells upon Adhesion to Endothelial Cells" Journal of Virology 21:10912-10923 (2015). DOI: 10.1128/JVI.01589-15.
- Liu, et al. "Immortalized Mouse Floxed Fam20c Dental Papillar Mesenchymal and Osteoblast Cell Lines Retain Their Primary Characteristics" Journal of Cellular Physiology 11:2581-2587 (2015). DOI: 10.1002/jcp.25008.
- Coleman, S et al. "A Homolog Pentameric Complex Dictates Viral Epithelial Tropism, Pathogenicity and Congenital Infection Rate in Guinea Pig Cytomegalovirus" PLoS Pathog 12.7:e1005755 (2016). DOI: 10.1371/journal.ppat.1005755. Application: Immortalization.
- Jester, JV et al. "PPARγ Regulates Mouse Meibocyte Differentiation and Lipid Synthesis" The Ocular Surface 14.4:484-494 (2016). DOI: 10.1016/j.jtos.2016.08.001. Application: Immortalization.
- Wang, ZY et al. "Immunogenicity of Renal Microvascular Endothelial Cells From Genetically Modified Pigs" Transplantation 100.3:533-537 (2016). DOI: 10.1097/TP.0000000000001070. Application: Immortalization.
- Auciello, F. R., Bulusu, V., Oon, C., Tait-Mulder, J., Berry, M., Bhattacharyya, S., ... & Vringer, E. "A stromal lysolipid–autotaxin signaling axis promotes pancreatic tumor progression" Cancer discovery 9(5):617-627 (2019).
- Tashiro, K., Segawa, T., Futami, T., Suzuki, M., & Itou, T. (2023). Establishment and characterization of a novel kidney cell line derived from the common bottlenose dolphin. In Vitro Cellular & Developmental Biology - Animal, 59(7), 536–549. https://doi.org/10.1007/s11626-023-00786-y
- Lee, Y., Berríos-Vázquez, G., Maes, R. K., Kiupel, M., Desmarets, L. M. B., Nauwynck, H. J., & Soboll Hussey, G. (2023). Development of immortalized feline respiratory epithelial cells in an air-liquid-interface culture system for feline herpesvirus-1 study. Virus Research, 326, 199063. https://doi.org/10.1016/j.virusres.2023.199064
- Zhou, N., Tian, Y., Wu, H., Cao, Y., Li, R., Zou, K., Xu, W., & Lu, L. (2022). Protective Effect of Resveratrol on Immortalized Duck Intestinal Epithelial Cells Exposed to H2O2. Molecules, 27(11), 3542. https://doi.org/10.3390/molecules27113542
- He, S., Xiao, X., Lei, R., Chen, J., Huang, H., Ailifeire Yilihamu, Guo, M., Tan, C., Li, X., Zhuang, Z., Saw, P. E., & Nie, Y. (2022). Establishment of Breast Phyllodes Tumor Cell Lines Preserving the Features of Phyllodes Tumors. BIO Integration, 4(1). https://doi.org/10.15212/bioi-2022-0025
- Welzel, J., Grüdl, S., Banowski, B., Stark, H., Sättler, A., & Welss, T. (2022). A novel cell line from human eccrine sweat gland duct cells for investigating sweating physiology. International Journal of Cosmetic Science, 44(2), 216–231. Portico. https://doi.org/10.1111/ics.12769
- Zhou, N., Tian, Y., Wu, H., Cao, Y., Li, R., Zou, K., Xu, W., & Lu, L. (2022). Protective Effect of Resveratrol on Immortalized Duck Intestinal Epithelial Cells Exposed to H2O2. Molecules, 27(11), 3542. https://doi.org/10.3390/molecules27113542
This product has no review yet.
Controls and Related Product: