CRISPR Scrambled sgRNA All-in-One AAV vector (with saCas9)

  • Product Name

    CRISPR Scrambled sgRNA All-in-One AAV vector (with saCas9)
  • Unit

    1.0 µg
  • Description

    Control CRISPR AAV with scrambled sgRNA and saCas9.

  • Target Sequence

    GCACTCACATCGCTACATCA
  • Storage Condition

    -20°C or below.

  • Disclaimer

  • Caution

    This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information.
    Publishing research using K070a? Please let us know so that we can cite the reference in this datasheet.
    K070a has not been cited in any literature.
    ABM community
    Verified customer
    Asked on Feb 28 2025
    Answer
    abm lentiviral transfer vectors use the third generation lentivirus system. It is based on the inactivated HIV genome. Note that our lentivirus packaging plasmids cannot be integrated into the host and are transiently expressed.
    ABM Scientific Support
    Answered on Feb 28 2025
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    We recommend using abm’s 2nd Generation Packaging System Mix (Cat. No. LV003) or 3rd Generation Packaging System Mix (Cat. No. LV053). abm’s lentiviral vectors have been tested and are compatible with Invitrogen’s packaging mix; we have not tested other suppliers and cannot guarantee compatibility.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    Higher MOI will provide more copies of the antibiotic resistance gene per cell. Cells containing multiple copies of the resistance gene can withstand higher antibiotic concentrations compared to those at lower MOIs. The concentration of antibiotic should be adjusted to a level that will cause selection for the desired population of transduced cells without going below the minimum antibiotic concentration you have established in your killing curve.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    MOI (Multiplicity of Infection) refers to the number of viral particles per cell used in the infection, e.g. an MOI of 5 indicates that there are five infectious units (IU) or transducing units (TU) for every cell. MOI is determined by calculating the numbers of viral particles added per well then divide this number by the number of cells seeded into the well. We also recommend transducing the cells with a range of MOIs as different cell types may require different MOIs for successful transduction.

    MOI = Product Titer (IU/ml) x Virus Volume (ml) / Total Cell Number
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    The concentration must be optimized for each cell type.  Typical selection amounts are around 0.1 - 0.5µg per ml.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    The standard RFP used in most of our vectors is mkate2. It has an excitation wavelength of 588nm and emission wavelength of 633nm.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    These are medium-high copy plasmids and should be propagated in a cloning E. coli strain such as DH5α. Typical yields from a 250ml culture is 300-500µg plasmid DNA.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    MOI stands for multiplicity of infection. Theoretically, an MOI of 1 will provide 1 virus particle for each cell on a plate, while an MOI of 10 represents ten virus particles per cell. However, several factors can influence the optimal MOI including cell line, cell type, transduction efficiency and gene of interest. We recommend first establishing an optimal MOI for each cell line. This can be done using a range of MOIs (0, 0.5, 1, 2, 5, 10, 50) to determine the MOI required to obtain optimal gene expression
    ABM Scientific Support
    Answered on Mar 24 2025
    There are currently no reviews for K070a.
    Please use the link above to contact us or submit feedback about this product.
×
Current vector selected:
CRISPR Scrambled sgRNA All-in-One AAV vector (with saCas9)
Cat. No.
K070a
Plasmid DNA Services
Midiprep Plasmid Amplification
10-20 µg
$75.00
Maxiprep Plasmid Amplification
80-100 µg
$150.00
Bacterial Agar Stab
1 stab
$40.00
Controls and Related Products
Susfectin™ Transfection Reagent
G4000
1.0 ml
$245.00
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
2nd Generation Packaging Mix
LV003
200 µl
$293.00
3rd Generation Packaging Mix
LV053
200 µl
$355.00
AAViralEntry™ Transduction Enhancer (100X)
G516
1.0 ml
$190.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
Empty
×
Current vector selected:
Cat. No.
Controls and Related Products
Susfectin™ Transfection Reagent
G4000
1.0 ml
$245.00
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
2nd Generation Packaging Mix
LV003
200 µl
$293.00
3rd Generation Packaging Mix
LV053
200 µl
$355.00
AAViralEntry™ Transduction Enhancer (100X)
G516
1.0 ml
$190.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
Empty
×
The vector and the related service will be deleted together.
×
Add the Blank Control Vector to cart?
ABM Assistant
👋 Wrong or incomplete answers mean that the data/columns/tables is missing or needs better descritions. Please write a description or let me know where specifically to find the information for more training.
;